Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1596229
End position: 1596252
Length: 24

DNA sequence
>NC_018500, from 1596229 to 1596252 (24 bp); Bacillus thuringiensis HD-771 TACATTTTCATTTACTTTTGCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1595843-1596313	Sequence	BTG_08175 - hypothetical protein (Protein is coded in complementary strand; from 1596313 to 1595843)