Sequence retrieval

Genome: Bacillus thuringiensis HD-771
Start position: 1192246
End position: 1192269
Length: 24

DNA sequence
>NC_018500, from 1192246 to 1192269 (24 bp); Bacillus thuringiensis HD-771 TGTTTCTATTTCTCTTTCTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1191557-1193017	Sequence	BTG_06075 - integral membrane sensor signal transduction histidine kinase (Protein is coded in complementary strand; from 1193017 to 1191557)