Sequence retrieval

Genome: Mycoplasma gallisepticum NC08_2008.031-4-3P
Start position: 541506
End position: 541535
Length: 30

DNA sequence
>NC_018413, from 541506 to 541535 (30 bp); Mycoplasma gallisepticum NC08_2008.031-4-3P GTTGGAGTTGGAGTTGGAGTTGGAGTTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 539529-541628	Sequence	HFMG08NCA_3177 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein (Protein is coded in complementary strand; from 541628 to 539529)