Sequence retrieval

Genome: Mycoplasma gallisepticum NC08_2008.031-4-3P
Start position: 268751
End position: 268786
Length: 36

DNA sequence
>NC_018413, from 268751 to 268786 (36 bp); Mycoplasma gallisepticum NC08_2008.031-4-3P TCAACCCAACACCTAACCCAACACCTAACCCAACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 268664-270718	Sequence	HFMG08NCA_1588 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein