Sequence retrieval

Genome: Mycoplasma gallisepticum NC08_2008.031-4-3P
Start position: 261145
End position: 261216
Length: 72

DNA sequence
>NC_018413, from 261145 to 261216 (72 bp); Mycoplasma gallisepticum NC08_2008.031-4-3P CCAACTCCAAACCCTGAACCAAAGCCAAAGCCAAATCCTGAGCCAAAGCCAAATCCAAACCCTGAACCAA AA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 261053-263131	Sequence	HFMG08NCA_1554 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein