Sequence retrieval

Genome: Mycoplasma gallisepticum NC08_2008.031-4-3P
Start position: 201488
End position: 201511
Length: 24

DNA sequence
>NC_018413, from 201488 to 201511 (24 bp); Mycoplasma gallisepticum NC08_2008.031-4-3P TAATCAATTGATCAATTGATCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 200995-201669	Sequence	HFMG08NCA_1199 cmk cytidylate kinase (Protein is coded in complementary strand; from 201669 to 200995)