Sequence retrieval

Genome: Mycoplasma gallisepticum CA06_2006.052-5-2P
Start position: 804673
End position: 804696
Length: 24

DNA sequence
>NC_018412, from 804673 to 804696 (24 bp); Mycoplasma gallisepticum CA06_2006.052-5-2P GGATTTGGGTTTGGAGTTGGTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 802174-804810	Sequence	HFMG06CAA_4715 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein (Protein is coded in complementary strand; from 804810 to 802174)