Sequence retrieval

Genome: Mycoplasma gallisepticum CA06_2006.052-5-2P
Start position: 801653
End position: 801706
Length: 54

DNA sequence
>NC_018412, from 801653 to 801706 (54 bp); Mycoplasma gallisepticum CA06_2006.052-5-2P GTTGGAGTTGGAGTTGGAGTTGGAGTTGGAGTTGGAGTTGGAGTTGGAGTTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 799643-801799	Sequence	HFMG06CAA_4698 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein (Protein is coded in complementary strand; from 801799 to 799643)