Sequence retrieval

Genome: Mycoplasma gallisepticum CA06_2006.052-5-2P
Start position: 792076
End position: 792099
Length: 24

DNA sequence
>NC_018412, from 792076 to 792099 (24 bp); Mycoplasma gallisepticum CA06_2006.052-5-2P TTTGGAGTTGGATTTGGATTTGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 789961-792210	Sequence	HFMG06CAA_4647 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein (Protein is coded in complementary strand; from 792210 to 789961)