Sequence retrieval

Genome: Mycoplasma gallisepticum CA06_2006.052-5-2P
Start position: 268293
End position: 268328
Length: 36

DNA sequence
>NC_018412, from 268293 to 268328 (36 bp); Mycoplasma gallisepticum CA06_2006.052-5-2P AACCCAACACCTAACCCAACACCTAACCCAACACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 268204-270270	Sequence	HFMG06CAA_1584 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein