Sequence retrieval

Genome: Mycoplasma gallisepticum CA06_2006.052-5-2P
Start position: 201053
End position: 201076
Length: 24

DNA sequence
>NC_018412, from 201053 to 201076 (24 bp); Mycoplasma gallisepticum CA06_2006.052-5-2P TAATCAATTGATCAATTGATCAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 200560-201234	Sequence	HFMG06CAA_1197 cmk cytidylate kinase (Protein is coded in complementary strand; from 201234 to 200560)