Sequence retrieval

Genome: Mycoplasma gallisepticum CA06_2006.052-5-2P
Start position: 260709
End position: 260780
Length: 72

DNA sequence
>NC_018412, from 260709 to 260780 (72 bp); Mycoplasma gallisepticum CA06_2006.052-5-2P CCAACTCCAAACCCTGAACCAAAGCCAAAGCCAAATCCTGAGCCAAAGCCAAATCCAAACCCTGAACCAA AA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 260617-262695	Sequence	HFMG06CAA_1550 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein