Sequence retrieval

Genome: Mycoplasma gallisepticum CA06_2006.052-5-2P
Start position: 446689
End position: 446724
Length: 36

DNA sequence
>NC_018412, from 446689 to 446724 (36 bp); Mycoplasma gallisepticum CA06_2006.052-5-2P AGCCCAACACCTAACCCAACACCTAACCCAACACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 446600-448672	Sequence	HFMG06CAA_2632 - variably expressed lipoprotein and hemagglutinin (VlhA) family protein