Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 471599
End position: 471652
Length: 54

DNA sequence
>NC_018268, from 471599 to 471652 (54 bp); Marinobacter sp. BSs20148 TAATCGCAACTGCAACTGCAACTGCAACTGCAACTGCAACTGCAACTGCAACTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 471483-471734	Sequence	MRBBS_0449 - hypothetical protein (Protein is coded in complementary strand; from 471734 to 471483)