Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2457686
End position: 2457733
Length: 48

DNA sequence
>NC_018268, from 2457686 to 2457733 (48 bp); Marinobacter sp. BSs20148 CTCCGTACAACTTTAGCTCTGTACGATTTTAGCTCTGTACAACGTTAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2457731-2458159	Sequence	MRBBS_2321 - hypothetical protein (Protein is coded in complementary strand; from 2458159 to 2457731)