Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 3911969
End position: 3912013
Length: 45

DNA sequence
>NC_018268, from 3911969 to 3912013 (45 bp); Marinobacter sp. BSs20148 TTCGGGGTAACCGGCTTCGGAGTAACCGGCTTCGGAGTAACCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3911960-3912151	Sequence	MRBBS_3748 - hypothetical protein (Protein is coded in complementary strand; from 3912151 to 3911960)