Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 3343218
End position: 3343262
Length: 45

DNA sequence
>NC_018268, from 3343218 to 3343262 (45 bp); Marinobacter sp. BSs20148 CCATCGACATAGGTGCTATCGACATAGGCGCTATCGACATAAGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3342810-3343280	Sequence	MRBBS_3186 - hypothetical protein (Protein is coded in complementary strand; from 3343280 to 3342810)