Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2818681
End position: 2818725
Length: 45

DNA sequence
>NC_018268, from 2818681 to 2818725 (45 bp); Marinobacter sp. BSs20148 TTCAGATGCCTACTTATCAGATGCCTGTTTATCAGGTGCCTATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF.. 2817903-2818682	Sequence	MRBBS_2653 lepB Signal peptidase I (Protein is coded in complementary strand; from 2818682 to 2817903)