Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2248559
End position: 2248603
Length: 45

DNA sequence
>NC_018268, from 2248559 to 2248603 (45 bp); Marinobacter sp. BSs20148 TCCTCTTCTAAAAGATCCTCTTCCAACAAATCCACTTCTGGAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2248322-2251279	Sequence	MRBBS_2129 - hypothetical protein (Protein is coded in complementary strand; from 2251279 to 2248322)