Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 3953175
End position: 3953214
Length: 40

DNA sequence
>NC_018268, from 3953175 to 3953214 (40 bp); Marinobacter sp. BSs20148 CTGGTCTAGTCTGGTCTAGTCTGGTCTGGTCTGGTCTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 3953215-3953844	Sequence	MRBBS_3791 - hypothetical protein (Protein is coded in complementary strand; from 3953844 to 3953215)