Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 470938
End position: 470973
Length: 36

DNA sequence
>NC_018268, from 470938 to 470973 (36 bp); Marinobacter sp. BSs20148 CCACCACCGCTACCACCGCTACCACCGCCGCCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 469786-471039	Sequence	MRBBS_0446 - hypothetical protein (Protein is coded in complementary strand; from 471039 to 469786)