Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2938101
End position: 2938136
Length: 36

DNA sequence
>NC_018268, from 2938101 to 2938136 (36 bp); Marinobacter sp. BSs20148 CAGGCGCCATCACCGGCACCATCACCGGCGCCATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2937725-2940043	Sequence	MRBBS_2770 parC DNA topoisomerase 4 subunit A (Protein is coded in complementary strand; from 2940043 to 2937725)