Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2781504
End position: 2781539
Length: 36

DNA sequence
>NC_018268, from 2781504 to 2781539 (36 bp); Marinobacter sp. BSs20148 ATTTTTAGCGAAGTTTTTGGCGAAATTGTTAGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 2781533-2782252	Sequence	MRBBS_2622 - hypothetical protein (Protein is coded in complementary strand; from 2782252 to 2781533)