Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2720050
End position: 2720085
Length: 36

DNA sequence
>NC_018268, from 2720050 to 2720085 (36 bp); Marinobacter sp. BSs20148 TCTTGTGACGTTTTTTGCGACGTTTGTTGTGACGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2719174-2720127	Sequence	MRBBS_2567 - UspA-related nucleotide-binding protein (Protein is coded in complementary strand; from 2720127 to 2719174)