Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2704755
End position: 2704790
Length: 36

DNA sequence
>NC_018268, from 2704755 to 2704790 (36 bp); Marinobacter sp. BSs20148 TTTCCTGCATTTTTCCCTGCATTCTTTCCTGCGTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2704710-2705825	Sequence	MRBBS_2555 recA Protein RecA (Protein is coded in complementary strand; from 2705825 to 2704710)