Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2594531
End position: 2594566
Length: 36

DNA sequence
>NC_018268, from 2594531 to 2594566 (36 bp); Marinobacter sp. BSs20148 GTTGATAGTGCTGTTGATAGCGCCGTAAATAGTGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2593872-2594585	Sequence	MRBBS_2453 miaE tRNA-(ms[2]io[6]A)-hydroxylase (Protein is coded in complementary strand; from 2594585 to 2593872)