Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2462959
End position: 2462994
Length: 36

DNA sequence
>NC_018268, from 2462959 to 2462994 (36 bp); Marinobacter sp. BSs20148 GAAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2462308-2463579	Sequence	MRBBS_2326 terA Tellurium resistance protein terA (Protein is coded in complementary strand; from 2463579 to 2462308)