Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2452558
End position: 2452593
Length: 36

DNA sequence
>NC_018268, from 2452558 to 2452593 (36 bp); Marinobacter sp. BSs20148 TTCGCCCCTTACTTCGCCCTTTACTTCACCCCGTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2452496-2453584	Sequence	MRBBS_2316 ruvB Holliday junction ATP-dependent DNA helicase RuvB (Protein is coded in complementary strand; from 2453584 to 2452496)