Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2287649
End position: 2287684
Length: 36

DNA sequence
>NC_018268, from 2287649 to 2287684 (36 bp); Marinobacter sp. BSs20148 TCTAACTCTAACTCTGGCTCTAACTCTAACTCTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2287211-2289502	Sequence	MRBBS_2158 - hypothetical protein (Protein is coded in complementary strand; from 2289502 to 2287211)