Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2745014
End position: 2745048
Length: 35

DNA sequence
>NC_018268, from 2745014 to 2745048 (35 bp); Marinobacter sp. BSs20148 TGACTGGTTACTGGTTACTGGTTACTGGTTACTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2744887-2745273	Sequence	MRBBS_2587 potI Putrescine transport system permease protein PotI