Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 3549969
End position: 3549995
Length: 27

DNA sequence
>NC_018268, from 3549969 to 3549995 (27 bp); Marinobacter sp. BSs20148 CGTTCAGTTCGCTCAGTTCGTTCAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3549779-3550054	Sequence	MRBBS_3384 - hypothetical protein (Protein is coded in complementary strand; from 3550054 to 3549779)