Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 3106001
End position: 3106027
Length: 27

DNA sequence
>NC_018268, from 3106001 to 3106027 (27 bp); Marinobacter sp. BSs20148 CAGCCGGTATAGCCGGTACCGCCGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3105796-3106548	Sequence	MRBBS_2950 - hypothetical protein (Protein is coded in complementary strand; from 3106548 to 3105796)