Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2981066
End position: 2981092
Length: 27

DNA sequence
>NC_018268, from 2981066 to 2981092 (27 bp); Marinobacter sp. BSs20148 TTATGGGCGTTATTGGCGTTATGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2980205-2981722	Sequence	MRBBS_2811 phaD putative K(+)/H(+) antiporter subunit D