Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 2002366
End position: 2002392
Length: 27

DNA sequence
>NC_018268, from 2002366 to 2002392 (27 bp); Marinobacter sp. BSs20148 TCACGGTGCTCGCGGTGCTCGCGGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2002222-2002821	Sequence	MRBBS_1884 - hypothetical protein (Protein is coded in complementary strand; from 2002821 to 2002222)