Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 3990056
End position: 3990079
Length: 24

DNA sequence
>NC_018268, from 3990056 to 3990079 (24 bp); Marinobacter sp. BSs20148 CACGGGCTCGGGCATGGGTACGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3989722-3990168	Sequence	MRBBS_3825 ywrC putative HTH-type transcriptional regulator ywrC (Protein is coded in complementary strand; from 3990168 to 3989722)