Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 3852836
End position: 3852859
Length: 24

DNA sequence
>NC_018268, from 3852836 to 3852859 (24 bp); Marinobacter sp. BSs20148 ACCATCACCATCACAATCACCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3852155-3852976	Sequence	MRBBS_3688 znuC Zinc import ATP-binding protein ZnuC