Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 3474752
End position: 3474775
Length: 24

DNA sequence
>NC_018268, from 3474752 to 3474775 (24 bp); Marinobacter sp. BSs20148 GTCGTCGGCGTCGTCGCCGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3473706-3475391	Sequence	MRBBS_3316 aceF Dihydrolipoyllysine-residue acetyltransferase component of pyruvate dehydrogenase complex (Protein is coded in complementary strand; from 3475391 to 3473706)