Sequence retrieval

Genome: Marinobacter sp. BSs20148
Start position: 241566
End position: 241589
Length: 24

DNA sequence
>NC_018268, from 241566 to 241589 (24 bp); Marinobacter sp. BSs20148 TTCTGGTCCTGGCTCTGGCTCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 240033-241679	Sequence	MRBBS_0229 atpA2 ATP synthase subunit alpha 2 (Protein is coded in complementary strand; from 241679 to 240033)