Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9938500
End position: 9938544
Length: 45

DNA sequence
>NC_018266, from 9938500 to 9938544 (45 bp); Amycolatopsis mediterranei S699 GGCCACCACCGCCGCCGCCACCCCCACCGCCACCACCACCACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9938106-9939242	Sequence	AMES_8943 - transglycosylase (Protein is coded in complementary strand; from 9939242 to 9938106)