Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9850055
End position: 9850078
Length: 24

DNA sequence
>NC_018266, from 9850055 to 9850078 (24 bp); Amycolatopsis mediterranei S699 GGTTGGGGCTGGGGTTGGGCTTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9848396-9850300	Sequence	AMES_8849 - hypothetical protein (Protein is coded in complementary strand; from 9850300 to 9848396)