Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9785767
End position: 9785790
Length: 24

DNA sequence
>NC_018266, from 9785767 to 9785790 (24 bp); Amycolatopsis mediterranei S699 CCGCCGCCGCGGCCGCCACCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9785199-9788009	Sequence	AMES_8789 - two-component system sensor kinase (Protein is coded in complementary strand; from 9788009 to 9785199)