Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9778725
End position: 9778754
Length: 30

DNA sequence
>NC_018266, from 9778725 to 9778754 (30 bp); Amycolatopsis mediterranei S699 GGCGGGGGTGGGGGCGGCGGCGGGGCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9778656-9780848	Sequence	AMES_8783 dnaX DNA polymerase III subunits gamma/tau (Protein is coded in complementary strand; from 9780848 to 9778656)