Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9775307
End position: 9775333
Length: 27

DNA sequence
>NC_018266, from 9775307 to 9775333 (27 bp); Amycolatopsis mediterranei S699 TCTGCTGCATCTGCTGCGCCTGCTGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9775015-9775374	Sequence	AMES_8777 - hypothetical protein (Protein is coded in complementary strand; from 9775374 to 9775015)