Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 965565
End position: 965627
Length: 63

DNA sequence
>NC_018266, from 965565 to 965627 (63 bp); Amycolatopsis mediterranei S699 CCGTGTCGACCCTTCAATCACGCGTGTCGACCGCTCAATCACGCGTGTCGACCCTTCCTGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF... 965600-966874	Sequence	AMES_0895 - hypothetical protein (Protein is coded in complementary strand; from 966874 to 965600)