Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9648086
End position: 9648110
Length: 25

DNA sequence
>NC_018266, from 9648086 to 9648110 (25 bp); Amycolatopsis mediterranei S699 CGCGCCGCGGCGTGCGGCGCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9647407-9649518	Sequence	AMES_8655 tmk dTMP kinase (Protein is coded in complementary strand; from 9649518 to 9647407)