Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9569386
End position: 9569409
Length: 24

DNA sequence
>NC_018266, from 9569386 to 9569409 (24 bp); Amycolatopsis mediterranei S699 GCCAGCGCGAGCGCCAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9568681-9569697	Sequence	AMES_8587 - endonuclease/exonuclease/phosphatase (Protein is coded in complementary strand; from 9569697 to 9568681)