Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9516889
End position: 9516912
Length: 24

DNA sequence
>NC_018266, from 9516889 to 9516912 (24 bp); Amycolatopsis mediterranei S699 TCCTCGGCCTCGTCGTCGACCTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9516814-9517656	Sequence	AMES_8534 - hypothetical protein (Protein is coded in complementary strand; from 9517656 to 9516814)