Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9473455
End position: 9473479
Length: 25

DNA sequence
>NC_018266, from 9473455 to 9473479 (25 bp); Amycolatopsis mediterranei S699 CCGGGCCGCGCAGGGCCGAGCCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9473007-9473813	Sequence	AMES_8492 - 2-keto-4-pentenoate hydratase (Protein is coded in complementary strand; from 9473813 to 9473007)