Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9454673
End position: 9454717
Length: 45

DNA sequence
>NC_018266, from 9454673 to 9454717 (45 bp); Amycolatopsis mediterranei S699 CCGCCGGTTTGGCGGAGGCCGGTTCGGCGGACGCCGGTTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9454426-9454863	Sequence	AMES_8472 - hypothetical protein (Protein is coded in complementary strand; from 9454863 to 9454426)