Sequence retrieval

Genome: Amycolatopsis mediterranei S699
Start position: 9448259
End position: 9448318
Length: 60

DNA sequence
>NC_018266, from 9448259 to 9448318 (60 bp); Amycolatopsis mediterranei S699 GCCGGACTTCTCGGGGCCGGACTTCTCGGGGCCGGACTTCTCGGGGCCGGACTTCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 9446850-9449939	Sequence	AMES_8467 - hypothetical protein (Protein is coded in complementary strand; from 9449939 to 9446850)